; ### from DNA Strider Monday, May 10, 1999 9:22:12 PM ; DNA sequence pFLX-5CG 7572 b.p. complete sequence ; AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGG AAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCC GGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTG CATGCCTGCAGGTCGACTCTAGAGGATCCATACTGTTACTAC*GTGAGGAGGGCTGCTTTTTAGTCCCCCTGAACCTTGA CTTCTCTGGATCAGAGGTGGGTGCTGACATGATGGCCcggattccgagacctcacaggtaaaaaagattacacagatact cgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaactcaaaagtcctcaacaaagagactc ctcgaagtttcacaaagcactggttatatactcttacaatggaacaacttatacgtcattagcaagctttccataggatg tggttttgcggttaggcagctgctagcgctttaactatgagtcatgctcagctatttccttttatcatttgttcgtaaac agtccctagtccataagcattctttctatttcttcagggttccaatactcatcccagtccacccttttttcttttttagg aggttcatcttcagaatctactgtgctgtctcccgttgtagaagtcgtgccaaatagcttcctgaagcgatcttctaact ctgtcatcatcctcttgaaggctttcttctttcttcttcttctttgtcttttccttttaccttacaatacatactttatt agtttgatttgattcgaaatggattcatatgacataccttcctcaaagggaagaactcagcacagtatctcccttataaa ataagtctgagatacttcatcattcctcctctttttcagacatgccacattgcctaccatttctcctcaattccatttgt ggttgtatttcttctccttctacttcaggcattgcaattactgtgtatcctagtatcttgtggatacaatttcttataca atcaaccaatgtaggtaaacataaaatcaataataacactcctaatcctattcccaagatacctcccaatagtcccttta aatattgtggaatatttcctatccatcctacccaatcttcccacttttgtaattgttgtatccctttcttcccttgtaca ttattttgttctatgtccattattatttcataaaacttttgttgtaaatcttttgtttggttataccattcccccaaagt tatatttccatgattccatattgtttgatttatagtcatattataccttgtccacaactcaggagggattttgcagaaaa attgattttgattacatcctaattcttgcatagcgaaagctgtatacaaaaatttttccatagcttctacttttaatcct attactagCTTCTATTAGGGGGGATCCTTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACT CCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGC AGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTG GCGGATCTTGAAGTTCGCCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACT CCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCC TCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGG CATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTGAAGGTGG TCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCG CCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGT GAACAGCTCCTCGCCCTTGCTCACCATGGCAGTCTAGAGTCGACCTGCAGgtcgaaaggcccggagatgaggaagaggag aacagcgcggcagacgtgcgcttttgaagcgtgcagaatgccgggcctccggaggaccttcgggcgcccgccccgcccct gagcccgcccctgagcccgcccccggacccaccccttcccagcctctgagcccagaaagcgaaggagcaaagctgctatt ggccgctgccccaaaggcctacccgcttccattgctcagcggtgctgtccatctgcacgagactagtgagacgtgctact tccatttgtcacgtcctgcacgacgcgagctgcggggcgggggggaacttcctgactaggggaggagtagaaggtggcgc gaaggggccaccaaagaacggagccggttggcgcctaccggtggatgtggaatgtgtgcgagccagaggccacttgtgta gcgccaagtgcccagcggggctgctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaatt cGGTTTCTTCGGAGTAGTAGTGTATACGCGTGTGCATATGCCACGCTTCTACGGGCATGCCTCGAGgagacttagctttt atggcagccaattttcctaatgcctcgagataccatgctctacactgcatcctagctggtgcaaatcttgcttctgcttg ttgttcttgagttaatcctatacccataatttctgctgcagtaaaatagggtaatggtctgggagcatcagggggatgtg tgcgatcatattctgctgtcagttgctttaagctttcatccaatatttctttatctgcagcgcaccctggtgcggccatt attaatgtggccatgtcagtaggtgttaaatttgcagagaaggcagtaaaccatagttgaacttcctcacctcctagtcc ttctcttgccttttccataaaaatggacaccatttttgggtcaagtgctacatattgtggtactccatttactgtttgaa taggatatgcctgtggagggccttcctcttttccacctgcttctttcatagatggcctagtgtctaatcccatttgagaa tacatattttcagctgcagcagcagtagacaccgtcatatttaaaagtcctgctaccgcaaagacttttaatgtcacaat tgccatatcaatttctttgctagatccaaatttttctcttctttcttgtaaatcgcaaataaccaaccttagttgatcta aagtctctggtatatcaccaggttctcgtcctgtagatacattagccattctaatggcccatctgaaattcccttctcca aattttttactcttcccccctactcctacagcaacattactacatctcttaatggccattttccaatctcgcccctgtcc attccccatgttgctgtagaatctctcctaccttgttgactgtccctcggcgaatctcctggcttgaaggtccgcgaaga gtcaccagatgtaatttatctgggcctttaaacaatgacttgattatgagctcgagtccgcttcactagagatactcact gttagcagcgtctgctactgcttccctatttaggtcagcaggagttctgcttaacagctttctattgctctagcttcact tcctcaatcactctcaatcaagtccctgttcgggcgccaactgcgaagttctcggcccggattccgagacctcacaggta aaaaagattacacagatactcgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaactcaaa agtcctcaacaaaGAGACTCCTCGAAGTTTCACAGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCAT TTGCGTCAACGGGGCGGGGTTATTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGT CAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGGTGTACTGCCAAAACCGCATCACC ATGGTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATAATGCCA GGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGGACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAG TTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGAC GTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGG GCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGCCAACATGGCGGTCATATTGGAC ATGAGCCAATATAAATGTACATATTATGATATAGATACAACGTATGCAATGGCCAATAGCCAATATTGATTTATGCTATA TAACCAATGAATAATATGGCTAATGGCCAATATTGAAGATCTGTCGAGCCATGTGAGCAAAAGGCCAGCAAAAGGCCAGG AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAG TCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTC CGACCCTGCCGCTTACCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGG CACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTT GACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTT TTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTT AACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCG ACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCT CCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTT TTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTAT TTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAA AAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCT CACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAA CAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCG CGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTAC TCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAA CACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATG TAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCA ATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGA GGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTG AGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGG AGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGA CCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTG ATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCT TCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCC GGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGT AGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCT GCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTG AACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAG AAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGG GAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTG ATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTT TTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCT CGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG //