; ### from DNA Strider Monday, May 10, 1999 9:27:49 PM ; DNA sequence FLX-CPL (SK Poly) 5898 b.p. complete sequence ; AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGG AAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCC GGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTG CATGCCTGCAGGTCGACTCTAGAGGATCCATACTGTTACTAC*GTGAGGAGGGCTGCTTTTTAGTCCCCCTGAACCTTGA CTTCTCTGGATCAGAGGTGGGTGCTGACATGATGGCCcggattccgagacctcacaggtaaaaaagattacacagatact cgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaactcaaaagtcctcaacaaagagactc ctcgaagtttcacaaagcactggttatatactcttacaatggaacaacttatacgtcattagcaagctttccataggatg tggttttgcggttaggcagctgctagcgctttaactatgagtcatgctcagctatttccttttatcatttgttcgtaaac agtccctagtccataagcattctttctatttcttcagggttccaatactcatcccagtccacccttttttcttttttagg aggttcatcttcagaatctactgtgctgtctcccgttgtagaagtcgtgccaaatagcttcctgaagcgatcttctaact ctgtcatcatcctcttgaaggctttcttctttcttcttcttctttgtcttttccttttaccttacaatacatactttatt agtttgatttgattcgaaatggattcatatgacataccttcctcaaagggaagaactcagcacagtatctcccttataaa ataagtctgagatacttcatcattcctcctctttttcagacatgccacattgcctaccatttctcctcaattccatttgt ggttgtatttcttctccttctacttcaggcattgcaattactgtgtatcctagtatcttgtggatacaatttcttataca atcaaccaatgtaggtaaacataaaatcaataataacactcctaatcctattcccaagatacctcccaatagtcccttta aatattgtggaatatttcctatccatcctacccaatcttcccacttttgtaattgttgtatccctttcttcccttgtaca ttattttgttctatgtccattattatttcataaaacttttgttgtaaatcttttgtttggttataccattcccccaaagt tatatttccatgattccatattgtttgatttatagtcatattataccttgtccacaactcaggagggattttgcagaaaa attgattttgattacatcctaattcttgcatagcgaaagctgtatacaaaaatttttccatagcttctacttttaatcct attactagCTTCTATTAGGGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGAC GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCT CCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGccgtcatatttaaaagtcctgctaccgcaaagacttttaatgt cacaattgccatatcaatttctttgctagatccaaatttttctcttctttcttgtaaatcgcaaataaccaaccttagtt gatctaaagtctctggtatatcaccaggttctcgtcctgtagatacattagccattctaatggcccatctgaaattccct tctccaaattttttactcttcccccctactcctacagcaacattactacatctcttaatggccattttccaatctcgccc ctgtccattccccatgttgctgtagaatctctcctaccttgttgactgtccctcggcgaatctcctggcttgaaggtccg cgaagagtcaccagatgtaatttatctgggcctttaaacaatgacttgattatgagctcgagtccgcttcactagagata ctcactgttagcagcgtctgctactgcttccctatttaggtcagcaggagttctgcttaacagctttctattgctctagc ttcacttcctcaatcactctcaatcaagtccctgttcgggcgccaactgcgaagttctcggcccggattccgagacctca caggtaaaaaagattacacagatactcgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaa ctcaaaagtcctcaacaaaGAGACTCCTCGAAGTTTCACAGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACC GCCCATTTGCGTCAACGGGGCGGGGTTATTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCAT TGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGGTGTACTGCCAAAACCGC ATCACCATGGTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATA ATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGGACTTGGCATATGATACACTTGATGTACTGCCAAGT GGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATT ATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCAT ATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGCCAACATGGCGGTCATA TTGGACATGAGCCAATATAAATGTACATATTATGATATAGATACAACGTATGCAATGGCCAATAGCCAATATTGATTTAT GCTATATAACCAATGAATAATATGGCTAATGGCCAATATTGAAGATCTGTCGAGCCATGTGAGCAAAAGGCCAGCAAAAG GCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACG CTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTC CTGTTCCGACCCTGCCGCTTACCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCT TTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCG CCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCT ATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCG AATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCA GCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGA CCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGC CTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAAC CCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAAT ATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTT TTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGA TCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTAT GTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTT GAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAG TGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGG ATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCT GTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTG GATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAG CCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACG ACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACT GTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCC TTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAA GGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTG TTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTC TAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCA GTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTC GGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGC TATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGC ACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATT TTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCT GGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGAT ACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG //