; ### from DNA Strider Monday, February 7, 2000 1:10:55 AM ; DNA sequence pFLX-FRG (RSV-GFP) 7058 b.p. complete sequence ; AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGG AAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCC GGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTG CATGCCTGCAGGTCGACTCTAGAGGATCCATACTGTTACTAC*GTGAGGAGGGCTGCTTTTTAGTCCCCCTGAACCTTGA CTTCTCTGGATCAGAGGTGGGTGCTGACATGATGGCCcggattccgagacctcacaggtaaaaaagattacacagatact cgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaactcaaaagtcctcaacaaagagactc ctcgaagtttcacaaagcactggttatatactcttacaatggaacaacttatacgtcattagcaagctttccataggatg tggttttgcggttaggcagctgctagcgctttaactatgagtcatgctcagctatttccttttatcatttgttcgtaaac agtccctagtccataagcattctttctatttcttcagggttccaatactcatcccagtccacccttttttcttttttagg aggttcatcttcagaatctactgtgctgtctcccgttgtagaagtcgtgccaaatagcttcctgaagcgatcttctaact ctgtcatcatcctcttgaaggctttcttctttcttcttcttctttgtcttttccttttaccttacaatacatactttatt agtttgatttgattcgaaatggattcatatgacataccttcctcaaagggaagaactcagcacagtatctcccttataaa ataagtctgagatacttcatcattcctcctctttttcagacatgccacattgcctaccatttctcctcaattccatttgt ggttgtatttcttctccttctacttcaggcattgcaattactgtgtatcctagtatcttgtggatacaatttcttataca atcaaccaatgtaggtaaacataaaatcaataataacactcctaatcctattcccaagatacctcccaatagtcccttta aatattgtggaatatttcctatccatcctacccaatcttcccacttttgtaattgttgtatccctttcttcccttgtaca ttattttgttctatgtccattattatttcataaaacttttgttgtaaatcttttgtttggttataccattcccccaaagt tatatttccatgattccatattgtttgatttatagtcatattataccttgtccacaactcaggagggattttgcagaaaa attgattttgattacatcctaattcttgcatagcgaaagctgtatacaaaaatttttccatagcttctacttttaatcct attactagCTTCTATTAGGGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGGATCCTTACTTGTACAGC TCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTT GCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGT AGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCGCCTTGATGCCGTTCTTCTGCTTG TCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTC GATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGT CCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCG GGGTAGCGGCTGAAGCACTGCACGCCGTAGGTGAAGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGT GCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTA CGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGGCAGTCTAGAGT CGACCTGCAGGCATGCAAGCTTGGAGGTGCACACCAATGTGGTGAATGGTCAAATGGCGTTTATTGTATCGAGCTAGGCA CTTAAATACAATTATCTCTGCAATGCGGAATTCAGTGGTTCGTCCAATCCATGTCAGACCTGTCTGTTGCCTTCCTAATA AGGCACGATCGTACCACCTTACTTCCACCAATCGGCATGCACGGTGCTTTTTCTCTCCTTGTAAGGCATGTTGCTAACTC ATCGTTACCATGTTGCAAGACTACAAGTGTATTGCATAAGACTACATTTCCCCCTCCCTATGCAAAAGCGAAACTACTAT ATCCTGAGGGGACTCCTAACCGCGTACAACCGAAGCCCCGCTTTTCGCCTAAACACACCCTAGTCCCCTCAGATACGCGT ATATCTGGCCCGTACATCGCGAAGCAGCGCAAAACGCCTAACCCTAAGCAGATTCTTCATGCAATTCCTGCAGCCCGGGG GATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGccg tcatatttaaaagtcctgctaccgcaaagacttttaatgtcacaattgccatatcaatttctttgctagatccaaatttt tctcttctttcttgtaaatcgcaaataaccaaccttagttgatctaaagtctctggtatatcaccaggttctcgtcctgt agatacattagccattctaatggcccatctgaaattcccttctccaaattttttactcttcccccctactcctacagcaa cattactacatctcttaatggccattttccaatctcgcccctgtccattccccatgttgctgtagaatctctcctacctt gttgactgtccctcggcgaatctcctggcttgaaggtccgcgaagagtcaccagatgtaatttatctgggcctttaaaca atgacttgattatgagctcgagtccgcttcactagagatactcactgttagcagcgtctgctactgcttccctatttagg tcagcaggagttctgcttaacagctttctattgctctagcttcacttcctcaatcactctcaatcaagtccctgttcggg cgccaactgcgaagttctcggcccggattccgagacctcacaggtaaaaaagattacacagatactcgacagggttcaat ctcaaatatttattgtatctgtgggagcctcaagggagaactcaaaagtcctcaacaaaGAGACTCCTCGAAGTTTCACA GAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGGGCGGGGTTATTACGACATTTT GGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTC AAACCGCTATCCACGCCCATTGGTGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTAGATGTACT GCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGG GGCGGACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAGTTTACCGTAAATACTCCACCCATTGACGTCAATG GAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAG GCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTAT TAATAACTAGTCAATAATCAATGCCAACATGGCGGTCATATTGGACATGAGCCAATATAAATGTACATATTATGATATAG ATACAACGTATGCAATGGCCAATAGCCAATATTGATTTATGCTATATAACCAATGAATAATATGGCTAATGGCCAATATT GAAGATCTGTCGAGCCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCC ATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGA TACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGCTTTCCCCGTCAAGC TCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATG GTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTC TTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTA TTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCA CTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGG GCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTC ATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTT AGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTAT CCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGT CGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTG AAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAA GAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCA ACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCA TGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGA GGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAA TGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCG AACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCG GCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGG GCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGA TCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTA AAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTT TTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCT GCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTA ACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGT AGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGT TGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAG CGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGA CAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATA GTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAAC GCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGA TTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAG TGAGCGAGGAAGCGGAAG //