; ### from DNA Strider Monday, May 10, 1999 9:26:55 PM ; DNA sequence pFLX-YCL (+3'LTRCTE, -RRE) 9957 b.p. complete sequence ; AGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGG AAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCC GGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTTG CATGCCTGCAGGTCGACTCTAGAGGATCCATACTGTTACTAC*GTGAGGAGGGCTGCTTTTTAGTCCCCCTGAACCTTGA CTTCTCTGGATCAGAGGTGGGTGCTGACATGATGGCCcggattccgagacctcacaggtaaaaaagattacacagatact cgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaactcaaaagtcctcaacaaagagactc ctcgaagtttcacaaagcactggttatatactcttacaatggaacaacttatacgtcattagcaagctttccataggatg tggttttgcggttaggcagctgCTAGAGCGCCGCGGACGGTGTGGTACCGGATCCCCAAGACATCATCCGGGCAGCACGG CTCCGGACATGTCACCCTTTTTAATTATAAAAAACAAAAGACACATCCCTCGGAGGCTGCGCCTGTCTTAGGTTGGAGTG ATACATTTCTTGTCACTATTACCCGTCATTGGATTAGGCAGTAGCTTTGACGGCCCTCCTGTCTTAGGTTAGTGAGAAAT GTCACTCTCTTACCCGTCATTGGCTGTCCAGTCTAGCTCACAGGGGAGGgtcgacCTCGAGTctagcgctttaactatga gtcatgctcagctatttccttttatcatttgttcgtaaacagtccctagtccataagcattctttctatttcttcagggt tccaatactcatcccagtccacccttttttcttttttaggaggttcatcttcagaatctactgtgctgtctcccgttgta gaagtcgtgccaaatagcttcctgaagcgatcttctaactctgtcatcatcctcttgaaggctttcttctttcttcttct tctttgtcttttccttttaccttacaatacatactttattagtttgatttgattcgGGCCGCtcgaaaatagtacataat ggatttccttacgcgaaatacgggcagacatggcctgcccggttattattatttttgacaccagaccaactggtaatggt agcgaccggcgctcagctggaattccgccgatactgacgggctccaggagtcgtcgccaccaatccccatatggaaaccg tcgatattcagccatgtgccttcttccgcgtgcagcagatggcgatggctggtttccatcagttgctgttgactgtagcg gctgatgttgaactggaagtcgccgcgccactggtgtgggccataattcaattcgcgcgtcccgcagcgcagaccgtttt cgctcgggaagacgtacggggtatacatgtctgacaatggcagatcccagcggtcaaaacaggcggcagtaaggcggtcg ggatagttttcttgcggccctaatccgagccagtttacccgctctgctacctgcgccagctggcagttcaggccaatccg cgccggatgcggtgtatcgctcgccacttcaacatcaacggtaatcgccatttgaccactaccatcaatccggtaggttt tccggctgataaataaggttttcccctgatgctgccacgcgtgagcggtcgtaatcagcaccgcatcagcaagtgtatct gccgtgcactgcaacaacgctgcttcggcctggtaatggcccgccgccttccagcgttcgacccaggcgttagggtcaat gcgggtcgcttcacttacgccaatgtcgttatccagcggtgcacgggtgaactgatcgcgcagcggcgtcagcagttgtt ttttatcgccaatccacatctgtgaaagaaagcctgactggcggttaaattgccaacgcttattacccagctcgatgcaa aaatccatttcgctggtggtcagatgcgggatggcgtgggacgcggcggggagcgtcacactgaggttttccgccagacg ccactgctgccaggcgctgatgtgcccggcttctgaccatgcggtcgcgttcggttgcactacgcgtactgtgagccaga gttgcccggcgctctccggctgcggtagttcaggcagttcaatcaactgtttaccttgtggagcgacatccagaggcact tcaccgcttgccagcggcttaccatccagcgccaccatccagtgcaggagctcgttatcgctatgacggaacaggtattc gctggtcacttcgatggtttgcccggataaacggaactggaaaaactgctgctggtgttttgcttccgtcagcgctggat gcggcgtgcggtcggcaaagaccagaccgttcatacagaactggcgatcgttcggcgtatcgccaaaatcaccgccgtaa gccgaccacgggttgccgttttcatcatatttaatcagcgactgatccacccagtcccagacgaagccgccctgtaaacg gggatactgacgaaacgcctgccagtatttagcgaaaccgccaagactgttacccatcgcgtgggcgtattcgcaaagga tcagcgggcgcgtctctccaggtagcgaaagccattttttgatggaccatttcggcacagccgggaagggctggtcttca tccacgcgcgcgtacatcgggcaaataatatcggtggccgtggtgtcggctccgccgccttcatactgcaccgggcggga aggatcgacagatttgatccagcgatacagcgcgtcgtgattagcgccgtggcctgattcattccccagcgaccagatga tcacactcgggtgattacgatcgcgctgcaccattcgcgttacgcgttcgctcatcgccggtagccagcgcggatcatcg gtcagacgattcattggcaccatgccgtgggtttcaatattggcttcatccaccacatacaggccgtagcggtcgcacag cgtgtaccacagcggatggttcggataatgcgaacagcgcacggcgttaaagttgttctgcttcatcagcaggatatcct gcaccatcgtctgctcatccatgacctgaccatgcagaggatgatgctcgtgacggttaacgcctcgaatcagcaacggc ttgccgttcagcagcagcagaccattttcaatccgcacctcgcggaaaccgacatcgcaggcttctgcttcaatcagcgt gccgtcggcggtgtgcagttcaaccaccgcacgatagagattcgggatttcggcgctccacagtttcgggttttcgacgt tcagacgtagtgtgacgcgatcggcataaccaccacgctcatcgataatttcaccgccgaaaggcgcggtgccgctggcg acctgcgtttcaccctgccataaagaaactgttacccgtaggtagtcacgcaactcgccgcacatctgaacttcagcctc cagtacagcgcggctgaaatcatcattaaagcgagtggcaacatggaaatcgctgatttgtgtagtcggtttatgcagca acgagacgtcacggaaaatgccgctcatccgccacatatcctgatcttccagataactgccgtcactccaacgcagcacc atcaccgcgaggcggttttctccggcgcgtaaaaatgcgctcaggtcaaattcagacggcaaacgactgtcctggccgta accgacccagcgcccgttgcaccacagatgaaacgccgagttaacgccatcaaaaataattcgcgtctggccttcctgta gccagctttcatcaacattaaatgtgagcgagtaacaacccgtcggattctccgtgggaacaaacggcggattgaccgta atgggataggttacgttggtgtagatgggcgcatcgtaaccgtgcatctgccagtttgaggggacgacgacagtatcggc ctcaggaagatcgcactccagccagctttccggcaccgcttctggtgccggaaaccaggcaaagcgccattcgccattca ggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgca aggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacgggatcgatctcgccatacagcgc gttgaaacgctgggcaatatcgcggctcagttcgaggtgctgtttctggtcttcacccaccggtaccagaccgccacggc ttacggcaataatgcctttccattgttcagaaggcatcagtcggcttgcgagtttacgtgcatggatctgcaacatgtcc caggtgacgatgtatttttcgctcatgtgaagtgtcccagcctgtttatctacggcttaaaaagtgttcgaggggaaaat aggttgcgcgagattatagagatcccAAGCTTtgaattccctaccaccacactgGGATCCCGGGCAGATCTTTAACGCGG CCGCCTCTGATCAGGATAACAGAGTGTTCctgcaggtcgaaaggcccggagatgaggaagaggagaacagcgcggcagac gtgcgcttttgaagcgtgcagaatgccgggcctccggaggaccttcgggcgcccgccccgcccctgagcccgcccctgag cccgcccccggacccaccccttcccagcctctgagcccagaaagcgaaggagcaaagctgctattggccgctgccccaaa ggcctacccgcttccattgctcagcggtgctgtccatctgcacgagactagtgagacgtgctacttccatttgtcacgtc ctgcacgacgcgagctgcggggcgggggggaacttcctgactaggggaggagtagaaggtggcgcgaaggggccaccaaa gaacggagccggttggcgcctaccggtggatgtggaatgtgtgcgagccagaggccacttgtgtagcgccaagtgcccag cggggctgctaaagcgcatgctccagactgccttgggaaaagcgcctcccctacccggtagaattcGGTTTCTTCGGAGT AGTAGTGTATACGCGTGTGCATATGCCACGCTTCTACGGGCATGCCTCGAGgagacttagcttttatggcagccaatttt cctaatgcctcgagataccatgctctacactgcatcctagctggtgcaaatcttgcttctgcttgttgttcttgagttaa tcctatacccataatttctgctgcagtaaaatagggtaatggtctgggagcatcagggggatgtgtgcgatcatattctg ctgtcagttgctttaagctttcatccaatatttctttatctgcagcgcaccctggtgcggccattattaatgtggccatg tcagtaggtgttaaatttgcagagaaggcagtaaaccatagttgaacttcctcacctcctagtccttctcttgccttttc cataaaaatggacaccatttttgggtcaagtgctacatattgtggtactccatttactgtttgaataggatatgcctgtg gagggccttcctcttttccacctgcttctttcatagatggcctagtgtctaatcccatttgagaatacatattttcagct gcagcagcagtagacaccgtcatatttaaaagtcctgctaccgcaaagacttttaatgtcacaattgccatatcaatttc tttgctagatccaaatttttctcttctttcttgtaaatcgcaaataaccaaccttagttgatctaaagtctctggtatat caccaggttctcgtcctgtagatacattagccattctaatggcccatctgaaattcccttctccaaattttttactcttc ccccctactcctacagcaacattactacatctcttaatggccattttccaatctcgcccctgtccattccccatgttgct gtagaatctctcctaccttgttgactgtccctcggcgaatctcctggcttgaaggtccgcgaagagtcaccagatgtaat ttatctgggcctttaaacaatgacttgattatgagctcgagtccgcttcactagagatactcactgttagcagcgtctgc tactgcttccctatttaggtcagcaggagttctgcttaacagctttctattgctctagcttcacttcctcaatcactctc aatcaagtccctgttcgggcgccaactgcgaagttctcggcccggattccgagacctcacaggtaaaaaagattacacag atactcgacagggttcaatctcaaatatttattgtatctgtgggagcctcaagggagaactcaaaagtcctcaacaaaGA GACTCCTCGAAGTTTCACAGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGGGC GGGGTTATTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGAC TTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGGTGTACTGCCAAAACCGCATCACCATGGTAATAGCGATG ACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCGTAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACC GTCATTGACGTCAATAGGGGGCGGACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAGTTTACCGTAAATACT CCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGG TCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGA CCCCGTAATTGATTACTATTAATAACTAGTCAATAATCAATGCCAACATGGCGGTCATATTGGACATGAGCCAATATAAA TGTACATATTATGATATAGATACAACGTATGCAATGGCCAATAGCCAATATTGATTTATGCTATATAACCAATGAATAAT ATGGCTAATGGCCAATATTGAAGATCTGTCGAGCCATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTA CCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAA AAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCAC GTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGA TTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACG TTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACC CGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGT GTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTC ATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTA AATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGA GTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTG GTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCT TGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTA TTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAA AAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTT ACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATC GTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTG CGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGC AGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCG GTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATG GATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATA TATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCA AAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTT TTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACC AACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCC ACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGAT AAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTG CACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTC CCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGA AACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG GCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCT TTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACG ACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG //