Boiling NaOH Mouse Tail gDNA Isolation

1. tag and tail mice as normal after 2-3 weeks of age
2. cut off 2mm each tail into wells of a 96 well plate
3. add 75ul lysis buffer and seal plate
4. incubate plate @958C for 10-60min and cool @48C for 15min
5. add 75ul 40mM Tris-HCl “unpHed” and mix well
6. use 1-2ul for each PCR reaction

Lysis Buffer
14ul conc. NaOH
14ul 0.5M EDTA pH 8.0
dH2O ->10ml
Program = 95
958C 60min
48C 15min
Reference:
BioTechniques Vol 29 No. 1 (2000) p52-54


Rb
RBEX3 5’ GCA TCT GCA TCT TTA TCG C 3’
RBI3 5’ CCC ATG TTC GGT CCC TAG 3’
PGK3’ 5’ GAA GAA CGA GAT CAG CAG C 3’
Expected Bands
Wt= ~380 bp
Mut= ~410 bp


p107
p107-NEO- 5’ACG AGA CTA GTG AGA CGT GC 3’
p107-WT 5’ TGT CCT GAG CAT GAA CAG AC 3’
p107-COM 5’ TCG CTG GCA GTC TGA GTC AG 3’
Expected Bands
WT: ~280 bp
Mutant: ~360 bp


p130
RB-PGK3' 5’ GAA GAA CGA GAT CAG CAG C 3’
122-WT 5’ TAC ATA GTT TCC TTC AGC GG 3’
p130-C1 5’ ACG GAT GTC AGT GTC ACG 3’
Expected Bands
WT: ~220 bp
Mutant: ~300 bp


Rb 2lox
Sequence around 5’ loxP site:
CTCTAGATCCTCTCATTCTTCCCTGGGTACATAAGATGCACACAGTGTGTAAAATCC
CTTACATCTGCTTCCTCAGCAATGCTTCTATCTCCTTATTAGACCAGAGATAATCTGA
CACAATAGGATCCGTTTAAACATAACTTCGTATAGCACACATTATACGAAGTTATAG
ATCCCAGATTTTACCTACAAACATACATTTAGAGGGTGGCATATTTCATTGAGGGGG
TATACTGAAAAATACTCTACCTACCAGAGTTACTCATTGCTCATCAGTTACTAAATG
AGTGCTGGGCTATGGTCAAGG

5’lox: CTC TAG ATC CTC TCA TTC TTC
3’lox: CCT TGA CCA TAG CCC AGC AC
Wild-type band ~260 nt, the lox band is ~308 nt, which can be resolved on a 1.5% gel
(sometimes a 3rd band is seen above the first two band, which I suspect is a PCR artefact due to the palindromic sequence of the loxP site…)


Rb 1lox
5’lox: CTC TAG ATC CTC TCA TTC TTC
RBCRE3-2: GGT TAA TGA AGG ACT GGG


p130 2lox
PCR around 5’ lox2722 site
p130-4595 GTA ACC ACT TAG CTG TAT CC
p130-4768r GAC TGC TGG TAT TAG AAC CC


p130 1lox
Delta PCR: to check for total recombination
Oligo before 5’ lox site = p130 4484 GTG TTG TAA CAT TCT CGT GG
Oligo after 3’ lox site = p130 6206r GTG GCT CGG AGG CTA AGA GC
Size of the band: non-deleted, ~1.8 kb
Deleted: ~330 bp


Cre cDNA PCR
k14cre3’ TTg CCC CTg TTT CAC TAT CCA g
k14cre5’ TgC TgT TTC ACT ggT TAT gCg g
Products (+)s = 700bp on 1-2% gel


Floxed p53 PCR
A CAC AAA AAC Agg TTA AAC CCA g
B AgC ACA TAg gAg gCA gAg AC
Products
A and B pair WT = 288 bp on 2% agarose gel -Floxed = 370 bp


Z/EG
Z/EG 1: AAg TTC ATC TgC ACC ACC g
Z/EG 2B: TgC TCA ggT AgT ggT TgT Cg
1 and 2B = 475 bp

Back to top

Last modified: October 10, 2005